Abstract
While Pacific oysters are important commercial aquaculture species worldwide, theeffect of hormonal regulation and environmental conditions on growth and tasteprofile have not been fully known. Insulin-like growth factor (IGF) systems areknown to play a major role in regulating neuroendocrine functions across variousphysiological processes and are particularly involved in growth. IGFs expressionalso is directly related to the nutritional status of vertebrates, however, fullmechanism has not been clearly identified in bivalves. In this study,differences in growth, IGFs expression, and taste according to cultivation siteof Pacific oysters were investigated. Oysters were collected in three differentspawning sites located on the south coast of Korea in July 2022 and hardeneduntil June 2023. Then, the oysters were cultured in two different growing sites(Tongyeong site, TS; Geoje site, GS) for six months. The total weight ofoysters, along with their condition index and tissue weight rate, wassignificantly higher in TS. Additionally, IGF expression was higher in TS duringmost of the sampled months. However, oysters from the GS scored higher in tasteevaluations. The IGFs system in oysters shows a similar trend to previousstudies, with higher levels in faster-growing individuals, suggesting oysters inTS were more adequately nourished by the surrounding environment in thisresearch. However, in taste evaluation, oysters from the GS showed betterresults than those from the TS. Despite these results, determining whether onesite is superior in certain aspects is still not fully possible, which warrantsfurther investigations.
Keywords: Pacific oyster, Regional characteristics, Growth, Insulin-like growth factors, E-tongue analysis
INTRODUCTION
The Pacific oyster, Crassostrea gigas, is a commercially valuablespecies with significant production volumes worldwide. In the mid-1990s, Pacificoyster aquaculture substantially improved, leading to increased production (). Most oysteraquaculture countries, such as China, Japan, and Korea, have developed spawningsites to produce better quality of seed. This means that the development ofgenetically improved broodstock can provide cost-effective seed for aquaculture andenhance profitability (Chen et al., 2022).In this process, to prevent the loss of genetic diversity in spawning sites, methodssuch as mass use of broodstock, balancing the sex ratio, artificial seedling, andintroducing wild individuals from distant locations were applied to increaseeffective seed production (In et al., 2016;Xu et al., 2019; Chen et al., 2022). Nevertheless, characteristic of spawningsite was not clearly apparent because growth is highly influenced by genetics, food,and environmental conditions (; Dridi et al.,2007; Çelik et al.,2015).
In previous studies, the Insulin-like growth factors (IGFs) system has beenidentified as a major factor in the neuroendocrine regulation of variousphysiological effects, such as growth and gonadal maturation in the Pacific oyster(Choi et al., 2018; ; ; ,b). Moreover, the concentration ofneuroendocrine proteins, including IGF, affects body growth in marine organisms(Andrews et al., 2011). The IGF systemin the Pacific oyster has three elements: the molluscan insulin-related peptide(MIP), known as the ligand; the IGF binding protein complex acid labile subunit(IGFBP-ALS), which aids in ligand migration and prolongs its half-life; and thereceptor of the ligand, called the C. gigas insulinreceptor-related receptor (CIR). However, the specific functions and mechanisms ofthese genes in growth and maturation have not been clearly identified (Hamano et al., 2005; Gricourt et al., 2006). Moreover, the regulation of IGFsystem is highly affected by nutrients and, thus, often expression is dependent onthe availability of food in sites where animals are being grown (;Diederich, 2006). In Korea, numerousstudies have shown clear differences in the formation and biomass of phytoplanktoncommunities in adjacent regions, regardless of the sea site, and similar patternsare observed overseas (Kang et al., 2006;Kim et al., 2020; Lin et al., 2020). In particular, Korea is known for thedifferent tastes and sizes of oysters due to variations in farming methods on thewest and south coasts. Additionally, habitat characteristics such as location andenvironmental factors affect the body composition, taste components, and size ofoysters (Kitaoka et al., 2016; Haisheng et al., 2019).
Oyster body composition, including fatty acids, amino acids, and glycogen, showsclear differences depending on the season, habitat, and harvest time (Hwang et al., 2016; Cho et al., 2023). Particularly, body composition andcondition index (CI) influence taste, while different species within theCrassostrea genus exhibit variations in taste (Murata et al., 2020; Liu et al., 2021). Although no specific food source can beidentified due to oysters’ nonselective feeding behavior, these factors arelikely influenced by water temperature and available food sources (Flores-Vergara et al., 2004; Tran et al., 2022).
Therefore, in this study, we aimed to confirm the differences in somatic growth,growth-related gene expression of IGF system members, and difference in taste ofPacific oysters collected at three different specific sites within twospecific-growing sites. The spawning and growing sites selected in this study havebeen used for seedling and cultivating natural spat since 1969, when mass productionthrough the aquaculture method was established (Lovatelli, 1988).
MATERIALS AND METHODS
1. Culture of pacific oyster
In July 2022, Pacific oyster spat, which are larvae that permanently attach to asurface on shell strings, were collected from Busan Gadeok-do (BS;35°04’32.7”N, 128°50’07.0”E),Tongyeong Suwol (TY; 34°52’58.3”N,128°18’10.7”E), and Namhae Galhwa (NH;34°54’24.8”N, 127°51’12.3”E) locatedat the southern coast of Korea. They were hardened at their respectivecollection sites; the BS and NH groups were hardened at their respectivecollection sites, while the TY group was hardened in Geoje until June 2023.After the hardening period, the oysters were transferred to separate growingsites in Tongyeong Yeongun site (TS; 34°47’28.2”N,128°25’46.3”E) and Geoje Eogu site (GS;34°49’07.1”N, 128°30’21.4”E) locatedat the southern coast of Korea, where they were grown until December 2023 (Fig. 1).
Fig. 1. Information on the specific spawning and growing sites of analyzedPacific oyster samples.
Open in a new tab
2. Sample collection
Thirty (30) Pacific oyster samples were collected monthly in each of the growingsite. Body parameters were measured using vernier calipers for shell length(SL), shell height (SH), and shell width (SW). Total weight (TW) and soft tissueweight (STW) were measured using an electronic balance to calculate the CI andtissue weight rate (TWR). The calculation followed the formulas of and . The adductormuscle was dissected and immediately frozen in liquid nitrogen, then stored at–80°C until analysis.
3. Reverse transcription polymerase chain reaction (RT-PCR)
To analyze the CIR, IGFBP_ALS, and MIP mRNA expression levels in the adductormuscle of Pacific oysters, the adductor muscles (n=3 per month) were cut into0.5 cm2 pieces, placed in a 1.5 mL microtube and subjected to totalRNA extraction using RNAiso PLUS (600 μL; Takara, Shiga, Japan). Then,samples were homogenized in chloroform and precipitated using isopropanol. Theisolated RNA pellets were washed with ethanol. Quantitative and qualitativeanalysis of the total RNA was conducted using a UV/VIS Nano spectrophotometer(MicroDigital, Seongnam, Korea) after dissolution in DNase/RNase-free water. Thetotal RNA was synthesized into complementary DNA (cDNA) using thePrimeScript™ 1st strand cDNA Synthesis Kit (Takara) following themanufacturer’s instructions. The synthesized cDNA was stored at–20°C until use in RT-PCR. PCR products were obtained using 10ng/μL of cDNA and EmeraldAMP GT PCR Master Mix (Takara) following themanufacturer’s instructions. The primers used in the analysis weredesigned based on the nucleotide sequences suggested by (Table 1). Gene expression for each target gene (CIR,IGFBP_ALS, and MIP) and the housekeeping gene (Elongation factor I alpha,EF1α) was analyzed using an Azure Biosystems C300analyzer (Azure Biosystems, Dublin, CA, USA), and the relative quantities weredetermined with GeneTools software (Syngene, Cambridge, UK).
Table 1. Oligonucleotide sequences of primers for the multiplex PCRassay.
| Primer name | Sequence (5’– 3’) | Amplicon size (bp) | Genbank no. | |
|---|---|---|---|---|
| Elongation factor Ialpha | Forward | GAAGGAAGCTGCTGAGATGGG | 776 | AB122066.1 |
| Reverse | GCCTCTGGGAGAGATTCGTG | |||
| Crassostreagigas insulin receptor-related receptor | Forward | CAAGACAGGGGAGGTGATCG | 537 | AJ535669.1 |
| Reverse | TACAGGTCCCTAGCAACCCC | |||
| Insulin-like growthfactor-binding protein complex acid labile subunit | Forward | AGATGCAGCCTAGGAGGGTC | 380 | XM_011417921.2 |
| Reverse | CTGAACGTGATGGACACCGGA | |||
| Molluscan insulin-relatedpeptide | Forward | CAAGATCCGCTCCCTGGAAG | 198 | NM_001308866.1 |
| Reverse | CCTCAAACTCCGCCACACTG | |||
Open in a new tab
4. Taste sensory analysis
To analyze the taste, three oysters, one from each spawning per growing site inDecember 2023, were randomly selected and grouped according to their growingsites. The soft tissue was weighed, and 1 mL of purified water was added per 1 gof tissue. It was then homogenized in an ice-cold bath until completely crushed.The homogenized tissues were subsequently centrifuged to collect thesupernatant. After that, a sample solution was made by adding 1 mL of thesupernatant to 99 mL of purified water in a standard 100 mL-capacity beaker.Consequently, the electronic tongue (e-tongue, ASTREE II, Alpha MOS, Toulouse,France) was subjected to pre-analysis calibration, conditioning, and diagnosticsto reach a constant potential for each of the seven potentiometric sensors (AHS,PKS, CTS, NMS, CPS, ANS, and SCS) and the Ag/AgCl reference electrodes beforeproper analysis. AHS, CTS, NMS, ANS, and SCS correspond to sourness, saltiness,umami, sweetness, and bitterness, respectively, while the remaining sensorsdetect other complex tastes. Sample solutions were analyzed according to asequence designed to measure three times. The resulting data were subjected tomultivariate analysis to assess variability among different growing sites.Sensor scores were linearly transformed into a two-dimensional principalcomponent analysis (PCA) for easier observation and interpretation of the data.The taste profiles were further represented on a radar chart with scales from 0to 12, indicating increasing relative intensity.
5. Statistical analysis
The IBM SPSS software version 22 (IBM, Chicago, NY, USA) was utilized forstatistical analysis. The statistical significance of somatic growth andgrowth-related gene expression in each growing sites for each month wasdetermined at the 95% confidence level using one-way analysis of variance(ANOVA), following the verification of data normality (Shapiro-Wilk test) andhomogeneity of variance (Levene’s test). Results are reported asmean±SEM.
RESULTS
1. Somatic growth in different growing sites
The TW and STW showed monthly growth, wherein TS showed significantly highergrowth than the GS (p<0.05). In particular, among thespawning sites, the NH group showed relatively lower growth than the othergroups (Fig. 2A and B). In terms of CI and TWR, the values of the TS weresignificantly higher than those of the GS in most months(p<0.05) (Fig. 2Cand D).
Fig. 2. Somatic growth of Pacific oysters by regional differences.
Open in a new tab
2. Growth-related gene expression
The mRNA expression of MIP and IGFBP_ALS was highest in July and August, with nosignificant difference between the growing sites(p>0.05). Following this peak, a similar decreasingtrend was observed across all sites, with no significant differences between thespawning sites (Fig. 3A and B). Unlike MIP and IGFBP_ALS, the expressionof CIR, IGFs receptor, did not exhibit any distinctive monthly trend (Fig. 3C). However, overall IGF mRNAexpression was higher in the TS compared to the GS.
Fig. 3. Growth-related mRNA expression of Pacific oysters by regionaldifferences.
Open in a new tab
3. Taste sensory profile
The taste sensory profile of Pacific oysters grown in different sites is shown asa result of multivariate PCA and a taste screening matrix. In the 2-dimensionalPCA, PC1 accounts for 68.116% and PC2 for 20.974%, totaling 89.09% variability.The high percentage of variance scores indicates an increased representation ofsensor scores within the total set of scores generated during the analysis. ThePCA plot revealed overlapping sensor scores, resulting in a negativediscrimination index value (–0.09). This negative discrimination indexsuggests that the overall taste characteristics are similar. However, given thevery low discrimination index figures, they likely indicate subtle differencesin taste (Fig. 4A). In terms of the tastescreening matrix, oyster that GS had a one-score higher umami intensity, and theintensified the saltiness, sweetness, bitterness and sourness flavor of oyster(Fig. 4B).
Fig. 4. E-tongue analysis of the visualized 2-D PCA plot (A) and radar map(B) of the taste attributes, showing regional differences in Pacificoysters.
Open in a new tab
DISCUSSION
Natural seedling is primarily used to obtain spat for oysters in Korea’saquaculture industry, while artificial seedling is also partially employed toproduce oysters of higher quality such as single oyster. Consequently, oysterspawning grounds have been established to ensure continuous and stable oysterfarming. Nevertheless, the relationship between location where the oyster grows andits influence on underlying physiological process of growth and taste profile werenot fully elucidated.
In the current study, oysters reared in TS generally showed higher growth rates thanthose that were grown in GS and, thus, oyster growth exhibited regional orlocation-dependent characteristics. Growth of oysters are known to be influenced byenvironmental factors such as temperature, phytoplankton abundance includingchlorophyll concentration and particulate organic matter (Toro et al., 1999). In the monitoring of the fisheryenvironment near the TS (34°47’19.0”N,128°25’39.0”E) and GS (34°49’21.0”N,128°29’29.0”E) it was showed that no major difference wasobtained on temperature, salinity, pH and dissolved oxygen level between TS and GSduring the sampling period (data not shown). However, chlorophyll concentration inthe surface layer near the TS (4.78±0.26 µg/L) was 1.34 µg/Lhigher than that in near the GS (3.43±1.69 µg/L) (Ministry of Oceans and Fisheries, 2024). Withregards to that, the concentration of dietary sources had effect on differences inoyster growth, and a high diversity and biomass of phytoplankton significantlyincreased the growth of farmed oysters in diatom-dominated sea areas (Toro et al., 1999; Rico-Villa et al., 2009). The concentration of chlorophyll onthe southern coast of Korea is about twice as high as on the east and west coasts,and diatoms, which are a food source for oysters, tend to dominate (; Jang et al., 2013). However, since the concentration ofchlorophyll varies greatly depending on the season and coastal sites that areheavily affected by land runoff, even if they are located adjacent to each other(Kim et al., 2023). Therefore,continuous research is needed to determine whether the above chlorophyllconcentration results are suitable for oyster growth.
In the results of mRNA expression in the adductor muscle of Pacific oysters, theexpression of MIP and IGFBP_ALS decreased after peaking in July and August. Thisfinding aligns with previous studies, which showed that MIP and IGFBP_ALS exhibitedseasonal expression changes, with both showing similar expression patterns and adecreasing trend starting in September (; ). Moreover, relatively higher expression of MIP and IGFBP_ALSin TS-grown compared to GS-grown oysters imply that nutritional status had asignificant effect on the expression of the IGF members, thereby promoting fastersomatic growth. In contrast, CIR mRNA did not display growth expression patterns inthis study. This suggests that the IGF system through the CIR do not significantlyaffect somatic growth of oysters, instead, showed regulating effect on gonadalmaturation, as shown by previous studies (Gricourtet al., 2006; ).
IGF-1 and IGF-2 stimulate the growth and development of vertebrates. Liver-derivedIGF-1 mediates the growth-promoting effects of GH from the hypothalamus afterhatching, whereas IGF-2 stimulates embryogenic growth and is not regulated by GH(Pierce et al., 2011). However, theclear function of IGFs in shellfish has not yet been identified, and the factorsinvolved are also unclear. The expression of the two IGFs was not related to eachother, and their expression trends were also unclear (data not shown). Nevertheless,IGFs protein expression in TS, which showed faster growth, was relatively high,consistent with growth outcomes and IGFs mRNA expression. In previous studies,larger individuals had higher expression of IGF-1 protein and its pathways. Theseresults were similar for mRNA expression, showing similar trends in both previousstudies and this study (Choi et al., 2018;).
The E-tongue imitate how the human tongue tastes the five essential taste senses andis currently used to evaluate the taste characteristic of food products. E-tongueanalysis lead up to for a rapid, impartial, and accurate assessment of the tasteattributes of food (;Marx et al., 2021). Oysters from theGS, which grew more slowly than those from the TS, showed a higher umami tasterating in the taste analysis results. Additionally, oysters nutritional content suchas protein, fat, ash, glycogen, and taurine vary considerably depending on theoyster's growing area (Lin et al., 2019). The artificial supply of certainmicroalgae (Chlorella vulgaris and Pavlovaviridis) led to changes in the fatty acid composition of Pacific oyster andan increase in umami values (Wang et al.,2022). Based on sensory evaluation, Pacific oysters with higher glycogencontent have a more sweet or rich taste (Murata etal., 2020). This simply cannot specify that glycogen has a sweet and richtaste, or that glutamic and aspartic acids have a umami taste. Since flavors such asflavor-enhancing nucleotides, betaine, volatile compounds, and free amino acidsaffect various attributes, continuous research is needed on the total amounts ofrelated ionic components and their combinations, in addition to e-tongue analysis().
IGF system is known as growth regulators wherein high expression indicates fastgrowth and low expression indicates otherwise. Further, its regulation is highlygoverned by exogenous factors including diet composition, temperature, among others,which could vary by location where the oysters are being reared. Oysters grown intwo separate locations-Konagai and Hiroshima in the western coast of Japan-showedvariable growth wherein higher body weight and soft weight were obtained in thelatter (Kitaoka, et al., 2016). Theresearchers further analyzed the taste components, and some sweet taste-associatedfree amino acid composition (serine, alanine) were significantly higher in Konagaicompared to Hiroshima. Similarly, Konagai-grown oysters have higher levels ofadenosine monophosphate (AMP), an important flavor compound found in marine animals,and show higher umami values in taste sensory tests. This earlier work showed thatsmaller individuals (relatively lower IGF expression) could have better tasteprofile than large (relatively higher IGF expression) oysters. The result of thecurrent study supports with above-mentioned study wherein GS-grown oysters, albeithad relatively low expression of IGF system and subsequent growth compared toTS-grown oysters, exhibited better taste sensory profile. However, when the largeindividual, the glycogen level is high, and it is different from previous studieswhere the AMP level was shown regardless of the size of the individuals (Hong et al., 2002; Murata et al., 2020). Although the flavor components ofoysters have been identified in various research, additional research is neededbecause the content of taste components in oysters varies significantly depending onseveral factors, such as the individual oyster, the specific site where they live,and the timing of their collection.
In conclusion, this study confirmed that the endocrine activity of IGFs and growthrates were higher in the TS, indicating a significant difference in growth based onthe Pacific oysters’ growing site. Meanwhile, taste sensory evaluation showedthat oysters from the GS had a greater variety of tastes, confirming that tastedifferences are also influenced by the growing site. The findings of the presentstudy imply that different environmental condition in growing site can be a goodindicator of production success and consumer taste preference, which can be appliedas strategic plan by oyster farmers in their culture operation. Nevertheless,additional location-specific environmental data, such as the phytoplankton profile(including chlorophyll concentration) and recent changes in seasonal water qualityparameters, continually need to be explored in regional investigations. Theseinformation can serve as key criteria for effective decision-making on what growingsites can sufficiently support growth and produce palatable oysters. As the taste ofoysters can vary depending on the environmental conditions of the growing site,which are likely to change indefinitely, determining which region is superiorwithout further investigation seems difficult to address.
Acknowledgements
This study was supported by a grant from the National Institute of Fisheries Scienceproject on the development of aquaculture and management techniques for theproduction of masstige single oyster (R2024029).
Conflict of interests
The authors declare no potential conflict of interest.
Authors’ contributions
Conceptualization: Lee HJ, Hur YB, Choi YH.
Data curation: Moon JS, Cadangin J.
Formal analysis: Moon JS, Kim SC, Lee ES, Cadangin J, Joo BH.
Methodology: Lee HJ, Park SJ, Hur YB, Choi YH.
Software: Kim SC, Cadangin J.
Validation: Moon JS, Cadangin J.
Investigation: Kim SC, Lee ES, Joo BH.
Writing-original draft: Moon JS.
Writing-review & editing: Moon JS, Lee HJ, Kim SC, Lee ES,Cadangin J, Joo BH, Park SJ, Hur YB, Nam TJ, Choi YH.
Ethics approval
This article does not require IRB/IACUC approval because there are no human andanimal participants.
REFERENCES
- Andrews KS, Beckman BR, Beaudreau AH, Larsen DA, Williams GD, Levin PS. Suitability of insulin-like growth factor 1 (IGF1) as a measureof relative growth rates in lingcod. Mar Coast Fish. 2011;3:250–260. doi: 10.1080/19425120.2011.588921. [DOI] [Google Scholar]
- Baghurst BC, Mitchell JG. Sex-specific growth and condition of the Pacific oyster(Crassostrea gigas Thunberg) Aquac Res. 2002;33:1253–1263. doi: 10.1046/j.1365-2109.2002.00788.x. [DOI] [Google Scholar]
- Çelik MY, Karayücel S, Karayücel İ, Eyüboğlu B, Öztürk R. The effects of environmental factors on survival, growth andbiochemical composition of transplanted oysters (OstreaedulisLinnaeus, 1758) from Aegean Sea to southern BlackSea. Aquac Res. 2015;46:959–968. doi: 10.1111/are.12253. [DOI] [Google Scholar]
- Chen Y, Xu C, Li Q. Genetic diversity in a genetically improved line of the Pacificoyster Crassostrea gigas with orange shell based onmicrosatellites and mtDNA data. Aquaculture. 2022;549:737791. doi: 10.1016/j.aquaculture.2021.737791. [DOI] [Google Scholar]
- Cho IK, Seo BS, Hwang SY, Lee YI, Moon JS, Park SJ, Lee HJ, Hur YB, Choi YH. The annual reproductive cycle, proximate composition, fatty acidand amino ccid content of Pacific oyster, Crassostrea gigas(Magallana gigas), in Gadeok-do, Korea. Dev Reprod. 2023;27:101–115. doi: 10.12717/DR.2023.27.3.101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Choi YH, Chang YJ. Gametogenic cycle of the transplanted-cultured pearl oyster,Pinctada fucata martensii (Bivalvia: Pteriidae) inKorea. Aquaculture. 2003;220:781–790. doi: 10.1016/S0044-8486(02)00304-6. [DOI] [Google Scholar]
- Choi YH, Kim EY, Nam TJ. Involvement of insulin-like growth factor in intraspecificvariation in growth of Pacific oyster Crassostrea gigasduring winter. Fish Sci. 2018;84:1017–1024. doi: 10.1007/s12562-018-1232-3. [DOI] [Google Scholar]
- Diederich S. High survival and growth rates of introduced Pacific oysters maycause restrictions on habitat use by native mussels in the WaddenSea. J Exp Mar Biol Ecol. 2006;328:211–227. doi: 10.1016/j.jembe.2005.07.012. [DOI] [Google Scholar]
- Dridi S, Romdhane MS, Elcafsi MH. Seasonal variation in weight and biochemical composition of thePacific oyster, Crassostrea gigas in relation to thegametogenic cycle and environmental conditions of the Bizert lagoon,Tunisia. Aquaculture. 2007;263:238–248. doi: 10.1016/j.aquaculture.2006.10.028. [DOI] [Google Scholar]
- Estívariz CF, Ziegler TR. Nutrition and the insulin-like growth factorsystem. Endocrine. 1997;7:65–71. doi: 10.1007/BF02778066. [DOI] [PubMed] [Google Scholar]
- Flores-Vergara C, Cordero-Esquivel B, Cerón-Ortiz AN, Arredondo-Vega BO. Combined effects of temperature and diet on growth andbiochemical composition of the Pacific oyster Crassostreagigas (Thunberg) spat. Aquac Res. 2004;35:1131–1140. doi: 10.1111/j.1365-2109.2004.01136.x. [DOI] [Google Scholar]
- Fuke S, Konosu S. Taste-active components in some foods: A review of Japaneseresearch. Physiol Behav. 1991;49:863–868. doi: 10.1016/0031-9384(91)90195-T. [DOI] [PubMed] [Google Scholar]
- Gricourt L, Mathieu M, Kellner K. An insulin-like system involved in the control of Pacific oysterCrassostrea gigas reproduction: hrIGF-1 effect ongerminal cell proliferation and maturation associated with expression of anhomologous insulin receptor-related receptor. Aquaculture. 2006;251:85–98. doi: 10.1016/j.aquaculture.2005.05.015. [DOI] [Google Scholar]
- Haisheng L, Xiaoming Q, Chaohua Z, Yanqiu H, Jialong G, Linlin L, Bei L, Faming Y. Comparative analysis of nutritional components and flavorcharacteristics of cultivated oyster from different coastal areas ofChina. South China Fish Sci. 2019;15:110–120. [Google Scholar]
- Hamano K, Awaji M, Usuki H. cDNA structure of an insulin-related peptide in the Pacificoyster and seasonal changes in the gene expression. J Endocrinol. 2005;187:55–67. doi: 10.1677/joe.1.06284. [DOI] [PubMed] [Google Scholar]
- Hong L, Xiaoxue W, Bin Z, Haiqing T, Changhu X, Jiachao X. Comparison of taste components between triploid and diploidoyster. J Ocean Univ Qingdao. 2002;1:55–58. doi: 10.1007/s11802-002-0031-7. [DOI] [Google Scholar]
- Hwang IJ, Han JC, Hur YB, Lim HJ. Seasonal variation in the body composition, amino acid, fattyacid and glycogen contents of triploid Pacific oyster, Crassostreagigas in western coastal waters of Korea. Korean J Malacol. 2016;32:269–277. doi: 10.9710/kjm.2016.32.4.269. [DOI] [Google Scholar]
- In VV, O’Connor W, Dove M, Knibb W. Can genetic diversity be maintained across multiple massselection lines of Sydney rock oyster, Saccostrea glomeratadespite loss within each? Aquaculture. 2016;454:210–216. doi: 10.1016/j.aquaculture.2015.12.030. [DOI] [Google Scholar]
- Jang PG, Hyun B, Cha HG, Chung HS, Jang MC, Shin K. Seasonal variation of phytoplankton assemblages related tosurface water mass in the eastern part of the South Sea inKorea. Ocean Polar Res. 2013;35:157–170. doi: 10.4217/OPR.2013.35.2.157. [DOI] [Google Scholar]
- Kang YS, Choi HC, Noh JH, Choi JK, Jeon IS. Seasonal variation of phytoplankton community structure innortheastern coastal waters off the Korean Peninsula. Algae. 2006;21:83–90. doi: 10.4490/ALGAE.2006.21.1.083. [DOI] [Google Scholar]
- Kim EY, Choi YH. Regulation of adductor muscle growth by the IGF-1/AKT pathway inthe triploid Pacific oyster, Crassostreagigas. Fish Aquat Sci. 2019;22:19. doi: 10.1186/s41240-019-0134-3. [DOI] [Google Scholar]
- Kim HC, Son S, Jo CO, Kim YH, Park M, Park YG, Ryu J. Spatio-temporal structures of satellite-derived water qualityindicators along the Korean South coast. Environ Int. 2023;178:108083. doi: 10.1016/j.envint.2023.108083. [DOI] [PubMed] [Google Scholar]
- Kim Y, Youn SH, Oh HJ, Kang JJ, Lee JH, Lee D, Kim K, Jang HK, Lee J, Lee SH. Spatiotemporal variation in phytoplankton community driven byenvironmental factors in the northern East China Sea. Water. 2020;12:2695. doi: 10.3390/w12102695. [DOI] [Google Scholar]
- Kitaoka C, Hosoe J, Hakamatsuka T, Araya K, Habara M, Ikezaki H, Hamada-Sato N, Shinagawa A, Yamamoto J, Kato-Yoshinaga Y. Taste component analysis of Pacific oysters cultured in Konagai,Nagasaki and taste evaluation using a taste-sensing system. Jpn J Food Chem Saf. 2016;23:63–71. [Google Scholar]
- Lin G, Chen Y, Huang J, Wang Y, Ye Y, Yang Q. Regional disparities of phytoplankton in relation to differentwater masses in the northwest Pacific Ocean during the spring and summer of2017. Acta Oceanol Sin. 2020;39:107–118. doi: 10.1007/s13131-019-1511-6. [DOI] [Google Scholar]
- Liu S, Xu H, Jian S, Xue Q, Lin Z. Molecular basis of taste and micronutrient content in Kumamotooysters (Crassostrea sikamea) and Portuguese oysters(Crassostrea angulata) from Xiangshanbay. Front Physiol. 2021;12:713736. doi: 10.3389/fphys.2021.713736. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lovatelli A. Status of oyster culture in selected Asian countries. 1988. Available from: https://www.fao.org/4/AB716E/AB716E09.htm. Access at Aug 3, 2024.
- Marx ÍMG, Veloso ACA, Casal S, Pereira JA, Peres AM. Sensory analysis using electronic tongues. In: Galanakis CM, editor. Innovative Food Analysis. Academic Press; Massachusetts, MA: 2021. pp. 323–343. (eds) [DOI] [Google Scholar]
- McAfee D, Connell SD. The global fall and rise of oyster reefs. Front Ecol Environ. 2021;19:118–125. doi: 10.1002/fee.2291. [DOI] [Google Scholar]
- Ministry of Oceans and Fisheries Monitoring the fishery environment. 2024. Available from: https://www.meis.go.kr/mei/observe/fge.do. Access at Jun 28, 2024.
- Moon JS, Choi YH. Multiplex PCR for the rapid detection of insulin-like growthfactor in the Pacific oyster, Crassostrea gigas: A usefulindicator for growth assessment. Mol Biol Rep. 2019;46:1023–1031. doi: 10.1007/s11033-018-4559-z. [DOI] [PubMed] [Google Scholar]
- Murata Y, Touhata K, Miwa R. Correlation of extractive components and body index with taste inoyster Crassostrea gigas brands. Fish Sci. 2020;86:561–572. doi: 10.1007/s12562-020-01417-1. [DOI] [Google Scholar]
- Oh HJ, Suh YS. Temporal and spatial characteristics of chlorophyllα distributions related to the oceanographicconditions in the Korean waters. Korean Assoc Geogr Inf Stud. 2006;9:36–45. [Google Scholar]
- Park SJ, Choi YH. Activity of insulin-like growth factor system during theembryogenesis of Pacific oyster (Crassostreagigas) Korean Soc Fish Mar Sci Educ. 2019;31:1424–1431. doi: 10.13000/JFMSE.2019.10.31.5.1424. [DOI] [Google Scholar]
- Park SJ, Choi YH. Effects of the insulin-like growth factor signaling on conditionindex in Pacific oyster (Crassostrea gigas) Korean Soc Fish Mar Sci Educ. 2021a;33:525–531. doi: 10.13000/JFMSE.2021.4.33.2.525. [DOI] [Google Scholar]
- Park SJ, Choi YH. Insulin-like growth factors-1 receptor (IGF-1R) expression andthe phosphorylation of rndogenous substrates lead to maturation of thePacific oyster, Crassostrea gigas. Dev Reprod. 2021b;25:67–72. doi: 10.12717/DR.2021.25.1.67. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Park SJ, Choi YH. Relationship between condition index values and expression levelsof gene and protein in the adductor muscle of diploid and triploid oystersCrassostrea gigas. Dev Reprod. 2022;26:165–174. doi: 10.12717/DR.2022.26.4.165. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pierce AL, Breves JP, Moriyama S, Hirano T, Grau EG. Differential regulation of Igf1 andIgf2 mRNA levels in tilapia hepatocytes: Effects ofinsulin and cortisol on GH sensitivity. J Endocrinol. 2011;211:201–210. doi: 10.1530/JOE-10-0456. [DOI] [PubMed] [Google Scholar]
- Rico-Villa B, Pouvreau S, Robert R. Influence of food density and temperature on ingestion, growthand settlement of Pacific oyster larvae, Crassostreagigas. Aquaculture. 2009;287:395–401. doi: 10.1016/j.aquaculture.2008.10.054. [DOI] [Google Scholar]
- Tan J, Xu J. Applications of electronic nose (e-nose) and electronic tongue(e-tongue) in food quality-related properties determination: Areview. Artif Intell Agric. 2020;4:104–115. doi: 10.1016/j.aiia.2020.06.003. [DOI] [Google Scholar]
- Toro JE, Paredes PI, Villagra DJ, Senn CM. Seasonal variation in the phytoplanktonic community, seston andenvironmental variables during a 2‐year period and oyster growth attwo mariculture sites, southern Chile. Mar Ecol. 1999;20:63–89. doi: 10.1046/j.1439-0485.1999.00066.x. [DOI] [Google Scholar]
- Tran BT, Kim KY, Heo JS, Park SJ, Park HK, Choi YH. Determination of the Pacific oyster Magallanagigas (Crassostrea gigas) diet composition intwo aquaculture farms by fecal DNA metabarcoding. Aquaculture. 2022;552:738042. doi: 10.1016/j.aquaculture.2022.738042. [DOI] [Google Scholar]
- Wang Q, Sun C, Chen L, Shi H, Xue C, Li Z. Evaluation of microalgae diets on flavor characteristics ofPacific oysters (Crassostrea gigas) duringfattening. Food Chem. 2022;391:133191. doi: 10.1016/j.foodchem.2022.133191. [DOI] [PubMed] [Google Scholar]
- Xu L, Li Q, Xu C, Yu H, Kong L. Genetic diversity and effective population size in successivemass selected generations of black shell strain Pacific oyster(Crassostrea gigas) based on microsatellites and mtDNAdata. Aquaculture. 2019;500:338–346. doi: 10.1016/j.aquaculture.2018.10.007. [DOI] [Google Scholar]
